# ###########################################	
# README data file
# ###########################################	
#
# supplementary material to: 
# 	G.Yeo, D.Holste, G.Kreimann, and C.B.Burge
# 	Variation in Alternative Splicing Across Human Tissues
#
# 	subdirectory: Additional data files - directory 1
#
# ###########################################	
# List files:  4 files
# ###########################################	
# List files are indicated as "list.FILENAME"
#
# list.identifiers.GENOA ......	list of unique GENOA identifiers for
#				each gene loci
# list.accession.cDNA .........	list of accession numbers of mapped
#				cDNA sequences
# list.accession.EST .......... list of accession numbers of mapped
#				EST sequences and tissue category
#				classification
# list.mapping.GENOA .......... list of GENOA identifiers, mapped 
#				cDNA and EST sequences
#  
# ###########################################	
# Data files: 24 files
# ###########################################	
# Data files are indicated as "FILENAME.map"
#  
# chr01.map
# chr02.map
# chr03.map
# chr04.map
# chr05.map
# chr06.map
# chr07.map
# chr08.map
# chr09.map
# chr10.map
# chr11.map
# chr12.map
# chr13.map
# chr14.map
# chr15.map
# chr16.map
# chr17.map
# chr18.map
# chr19.map
# chr20.map
# chr21.map
# chr22.map
# chrX.map 
# chrY.map
#
# Content
# -------
# Data files contain spliced alignments of gene loci, inferred by human 
# cDNAs:genomic and EST:genomic mappings
#
# chr01, chr02, ..., chr22.map, and chrX.map and chrY.map files contain 
# altogether 185,106 internal, human exons
# 
# Data structure
# --------------
# >GENOA_ID:chr22.Ctg10.G1-30:GENBANK_ID:14060939:EXON_TYPE:SE:EXON_LEN:68
# atgttttattatccattcag|gtgctaacggatggaagggttgtttctacctgttggcca
# ttgtggatgatgttgctatgcatattggg|gtacgagtat

#	GENOA_ID ......	unique gene/transcript sequence region identifier
#	chr ........... human chromosome number
#       ic ............ inverse compliment of forward strand (optional)
#	GENBANK_ID .... GenBank accession number	
#	EXON_TYPE ..... exon classification 			
#			CE ....... constitutively spliced exon
#                       SE ....... skipped exon
#                       A3E ...... alternative 3'splice site exon
#                       A5E ...... alternative 3'splice site exon
#	EXON_LEN ...... exon length in bases
#	Sequence ...... upstream 20 bp flanking intron sequence, exon 
#			and downstream 10 bp flaking intron sequences
#
#
# ###########################################	
# Last updated:  Mon Jul  5 16:19:30 EDT 2004
# ###########################################